Doctors in support of law reform for voluntary euthanasia

To the Editor: The perspective of the Doctors for Voluntary Euthanasia Choice needs to be challenged.1 Firstly, irrespective of one’s views on the matter, it does not seem reasonable for euthanasia to be legalised so that doctors can avoid the scrutiny of the law. Secondly, the authors point out that “pain may not be a prominent symptom, making death by morphine legally unjustifiable”, therefore implying that morphine has a “double effect” of sedation and hastening death.

The claim that morphine has efficacy in causing death is erroneous. The principle of “double effect” was first expounded in a trial in 1957, where prosecution and defence expert witnesses differed as to the excess or otherwise of the amount of opioids delivered by a doctor in unrecorded doses to a patient.2

The prevailing medical view then was that morphine in high enough doses caused respiratory depression and consequent death, implying that morphine influences its timing and causation. However, experience over the past 5 decades has shown that the safe and effective use of morphine, other analgesics and sedatives relieves pain and distress but does not cause death.3 This is because tolerance to respiratory depression occurs fairly rapidly with regular consistent use, and underlying pain antagonises respiratory and sedative effects.4 But opioids, like any drug, if used inappropriately, will be dangerous.

Therefore the use of the “double effect” defence is not possible. Regardless of whether one supports euthanasia or not, doctors’ actions should be subject to scrutiny to protect the public and their own moral and ethical standards. “Get out of jail free cards” should not be allowed to justify bad medicine.

Doctors in support of law reform for voluntary euthanasia

To the Editor: The Doctors for Voluntary Euthanasia Choice want Australia to have enlightened euthanasia laws similar to those of the Netherlands.1 But a recent review of Dutch physician-assisted death (PAD) suggests that such practices are extremely difficult to control.2

They state that there has been some improvement in the rate of reporting of cases of euthanasia (a legal requirement), although only 2% of deaths classifiable as euthanasia but employing morphine rather than muscle relaxants are reported.

Throughout the 1990s, it was reported that about 1000 patients a year were euthanased without request. The most common reasons given for not discussing euthanasia with these patients were that they were unconscious, they had a psychiatric disorder or dementia, or “assistance in dying was clearly in the best interest of the patient”. This provides a chilling insight into who is being killed.

In 2005 it was reported that there had been a fall in the incidence of euthanasia, but there was a compensatory rise in deaths involving palliative sedation (which do not have to be reported), and it was alleged that doctors were choosing this less administratively onerous alternative.

In the review, much is made of a special relationship between Dutch general practitioners and their patients, but one expert admits that “some physicians practice PAD without the emotional sensitivity that we have agreed is necessary”.

The latest Dutch report, for 2010, shows that the rate of euthanasia has increased again, the number of unreported cases has increased, the rate of euthanasia without request is a little lower but persists, and deaths involving palliative sedation have jumped 150% in 5 years.3

Despite claims that comprehensive regulatory mechanisms are in place, it seems that the Dutch are no closer to controlling PAD than when they started 30 years ago.

No one could seriously want this in Australia.

Doctors in support of law reform for voluntary euthanasia

In reply: We thank Dunne and Woodruff for comments on our Perspectives article.1 Both colleagues firmly expressed their opinions. However, we find it telling that neither mentioned consideration of their patients’ opinions and both referred to euthanasia, not voluntary euthanasia (VE), which was the subject of our article.

We agree with Dunne that “it does not seem reasonable for euthanasia to be legalised so that doctors can avoid the scrutiny of the law”. However, we are at a loss to understand his logic in suggesting that legalisation of VE would enable doctors to avoid scrutiny. Scrutiny would be enhanced by defining legal and open processes to be followed, thus satisfying Dunne’s own requirement that doctors should have their actions “subject to scrutiny to protect the public and their own moral and ethical standards”.

We accept Dunne’s personal view that titrated administration of morphine and other drugs is “safe” (notwithstanding a known failure rate with palliative care2). Indeed Dunne acknowledges that the presence of underlying pain may be required to act as an antagonist to respiratory depression and the sedative effects of opioids. However, emphasis on pain alleviation ignores that it is loss of autonomy, dignity and all life enjoyment, rather than pain, that provokes persistent and rational requests for assistance to achieve a peaceful death at a time of one’s choice, surrounded by loved ones.3

Woodruff refers to a book of essays to argue that VE laws cause non-voluntary euthanasia (NVE). He ignores published peer-reviewed research,4 any reading of which suggests that end-of-life practices in the Netherlands are transparent and safe, exposing the rate of doctor NVE in Australia as five times the Dutch rate at the time4,5 and establishing that the Dutch rate of NVE has dropped considerably since legislative reform.4

We believe that VE laws would fulfil a need in Australian medicine without the sequelae that concern Dunne and Woodruff.

Polypharmacy in the terminally ill

To the Editor: A significant number of patients who receive palliative care are over 65 years of age. In addition to their terminal illness, they often have other medical comorbidities. Long-term medical management of these conditions can evolve into a large regimen of medications. Patients may continue to take these medications as they enter the terminal phase of their illness, but it is often unnecessary and to their detriment.1

We performed a retrospective chart review between 8 July and 6 October 2010 to determine the prevalence of polypharmacy in 50 consecutive patients aged over 65 years who were admitted to the Palliative Care Unit (PCU) at Redcliffe Hospital and who died during that admission. Because patients receiving palliative care are invariably prescribed several medications for symptom control (analgesics, laxatives and antiemetics), we adopted a liberal total as the cut-off and deemed that nine or more medications constituted polypharmacy for this cohort.

The mean age of patients was
76.9 years and 17 were women. Polypharmacy was prevalent (21 patients). The median number of medications per patient on admission was seven, with men prescribed
a median of seven, and women a median of eight. Patients aged 66–74 years were on a median of 10 medications compared with seven
for patients aged 75 years and over. The total number of medications prescribed to the cohort of 50 patients at the time of admission was 427. By 72 hours after admission, 285 of these (67%) had been ceased. The median time from the patient’s admission to their death was 7 days.

The results of our study suggest
a need for vigilance in identifying polypharmacy in the terminally
ill. Effective management of polypharmacy involves discontinuing medications deemed no longer necessary, if it is safe to do so. This can be achieved by regular review of a palliative care patient’s medications by the physicians involved in their care — for example, the primary care physician, oncologist and palliative care physician — as the patient approaches the terminal phase of their illness. In our experience, regular review is more likely to be done if one physician is identified as having responsibility for this.

Stent insertion for palliation of advanced oesophageal carcinoma symptoms by level of socioeconomic disadvantage in urban New South Wales

To the Editor: For patients with advanced oesophageal carcinoma, palliation of debilitating symptoms such as dysphagia and odynophagia is important for improving quality
of life.1 Owing to the possibility
of complications, it is generally recommended that stents be used as a palliative measure when expected survival is less than 3 months.2 We analysed linked records from the NSW Central Cancer Registry, the NSW Admitted Patient Data Collection, NSW Registry of Births, Deaths and Marriages death registrations data and Australian Bureau of Statistics mortality data to investigate the association between socioeconomic disadvantage and palliation of advanced (stage IV) oesophageal carcinoma symptoms by stent insertion in urban-dwelling patients in New South Wales, from July 2001 to December 2007. The study was approved by the NSW Population and Health Services Research Ethics Committee.

Of the 479 patients who were diagnosed with primary advanced oesophageal carcinoma before death and for whom linked hospital records were available, 28.4%
(136 patients) received stents. The proportion who received stents decreased with increasing disadvantage (P = 0.006 for association; P < 0.001 for trend). After adjustment for patient and tumour characteristics, greater disadvantage remained significantly associated with decreasing odds of stent insertion (Box) (P = 0.01 for association; P = 0.001 for trend). Dysphagia or oesophageal obstruction was reported for some patients and was associated with receiving a stent (χ2 test, P < 0.001) but not associated with level of socioeconomic disadvantage (χ2 test, P = 0.37). As this information is more likely to be reported for those who received a stent, it was not included in the multivariable analysis of association between stenting and socioeconomic disadvantage.

Increased socioeconomic disadvantage has been associated with reduced access to treatment for many cancers.3 Further, research on access to palliative care (generally and for advanced cancer in Australia) has identified barriers such as lack of standardised referral processes and lack of consensus about appropriate timing for access to palliative care.4,5 These factors, plus others that could not be measured reliably or at all from the data we used (such as indication for stenting, patient choice, and use of chemotherapy and radiotherapy), are likely to have contributed to the variation we observed.

For patients with expected survival of less than 3 months, stenting is recommended over alternative treatments such as brachytherapy.2 Because the proportion of patients with less than 3 months between diagnosis and death increased with increasing disadvantage (P = 0.004 for trend), immediate palliation of symptoms by stenting should be a priority for more disadvantaged patients. Later diagnosis for more disadvantaged patients may contribute to the observed variation in stenting, but is at odds with recommended treatment.2 Although patients who die soon after diagnosis may have reduced opportunity to receive a stent, excluding patients who survived
1–2 months after diagnosis made no difference to the findings.

Given the variation in use of stents by level of socioeconomic disadvantage that we observed and the possible role of other factors, further research is required to fully understand patient and health system factors that affect access to palliative care for patients with advanced oesophageal carcinoma. Understanding treatment pathways for more disadvantaged patients should be a priority because stent insertion can provide patients with immediate improvement to quality of life.

Association between stent insertion and socioeconomic disadvantage in 479 urban-dwelling patients with advanced oesophageal carcinoma, New South Wales, 2001–2007

Quintile of socioeconomic disadvantage*	No. (%) of patients	No. (%) of patients who died ≤ 3 months after diagnosis	No. (%) of patients who had stent inserted	Adjusted odds ratio† (95% CI)

Least disadvantaged	87 (18.2%)	26 (29.9%)	37 (42.5%)	2.00 (1.10–3.64)
Second least disadvantaged	102 (21.3%)	38 (37.3%)	32 (31.4%)	1.22 (0.67–2.23)
Middle	122 (25.5%)	56 (45.9%)	32 (26.2%)	1.00‡
Second most disadvantaged	96 (20.0%)	46 (47.9%)	22 (22.9%)	0.85 (0.45–1.60)
Most disadvantaged	72 (15.0%)	32 (44.4%)	13 (18.1%)	0.60 (0.29–1.26)
All	479 (100.0%)	198 (41.3%)	136 (28.4%)	—

* Quintiles of the Index of Relative Socio-Economic Disadvantage, based on the local government area of each patient’s residence at the time of diagnosis. † Model included: age group, sex, country of birth, year of diagnosis, diagnostic group (oesophageal squamous cell carcinoma, oesophageal adenocarcinoma, and other specified or unspecified oesophageal carcinoma), number of comorbidities, and time between diagnosis and death (≤ 3 months or > 3 months). The Hosmer–Lemeshow test indicated that the model was a reasonable fit (χ2 = 7.02, df = 8, P = 0.54). ‡ Reference category.

Palliative care is everyone’s business — is it yours, doctor?

To the Editor: “Palliative care is everyone’s business” is the theme of Palliative Care Australia’s advocacy in 2013 and of Palliative Care Week,
19–25 May 2013. It is a timely and relevant slogan. Palliative care, once isolated in hospices for advanced cancer, is now a core medical discipline and a specialty established in major hospitals and universities, with community programs extending care to most advanced illness — respiratory, cardiac, renal and neurological — and to aged care.

“Everyone’s business” aims first at the wider community, proclaiming the concern of palliative care as quality of living, not speeding of dying. Well managed care for patients with advanced and terminal illness creates its own publicity — attending family members say, “I want my death to be like that”.

It is also relevant for health professionals, who say to the patient, “you are not ready for that, yet”, as they try another intervention for serious illness. “Everyone’s business” affirms management that is ready to refocus, frankly assess the best interests of the patient and explore relevant palliative options.

When palliative care becomes everyone’s business, it will be featured in everyday media, in all health education, and offered throughout health care. The trials of ageing and advanced illness will be faced more squarely, with open discussion.

Advance care directives and the nomination of substitute medical decisionmakers remain little used. Conversation is more important than a written document. Open sharing to clarify values and hopes will help avoid futile measures, support best palliation and avoid unnecessary transfers to acute care, or futile life-support measures in emergency or intensive care.

The opportunity to die at home has wide community support. It allows family to travel with the patient along the final pathway. Families whose loved ones wish to die at home should seek this opportunity for them, private and public funding should support home care more strongly (it is usually cheaper), and providers should be challenged with the question: how often do you offer care at home for your terminally ill patients?

Improvement will see palliative care taught in undergraduate courses and extend to the years after graduation. Palliative care needs to be incorporated in the experience and practice of every generalist and specialist practitioner, becoming indeed “every doctor’s business”.

Meeting end-of-life care needs for people with chronic disease: palliative care is not enough

. . . but what should a system that successfuly combines interventional and palliative approaches look like?

Considerable efforts have been made, both nationally and internationally, to address the growing “epidemic” of chronic disease. Chronic disease accounts for more than half of all Australian deaths,1 treatment of chronic disease in Australia accounts for almost 70% of total health expenditure2 and hospitalisations associated with chronic disease are a major component of this expenditure (see the Box for a definition of chronic disease as used in the context of this article). Systematic processes to prevent and manage chronic disease have been developed, and all incorporate the concept of a continuum of care from prevention and early intervention, through disease management to the end of life.2 While there is a strong focus on systematic care, health education, chronic disease self-management and regular review, comparatively scant attention is paid to the actual care required as people approach the end of their life.

In Australia, to date, the need for end-of-life care for people with advanced chronic disease has been addressed by recommending referral to a specialist palliative care service or by developing closer links between these services and specific disease services and primary care.5 It is assumed that a referral to palliative care can, and will, provide the most appropriate care for people dying with a chronic disease. However, often this process is poorly handled, and general practitioners and primary care clinicians are left to manage an uncoordinated and challenging situation. Inadequate and inappropriate end-of-life care has significant and costly implications: unnecessary hospitalisations; prolonged intensive interventions in acute care settings; patients dying in intensive care units rather than in their preferred place of death; poor symptom management; little opportunity for patients and their families to discuss issues around death and dying; and increasing stress on staff who are not trained in the provision of palliative care.

Originally, palliative care developed to provide support for people dying with cancer, with a trajectory of relatively predictable deterioration requiring intensive support over a fairly short period of time. Chronic disease tends to follow a much slower and more unpredictable trajectory that includes progressive functional decline, poor quality of life and increasing dependency on both formal and informal caregivers as well as the health system. Many people with chronic disease have multiple comorbidities, so it is vital they have access to active and systematic disease management.3 However, there is a concurrent need for supportive and palliative care to effectively control distressing symptoms and to provide emotional, spiritual and psychological support for the patient and his or her family as the patient’s condition slowly deteriorates.5 Referral to specialist palliative care can mean that patients may not continue to have access to active disease management. A system that not only allows but actively supports the provision of active and palliative care is required.

Disease-focused health professionals and palliative care professionals may sometimes differ in their philosophical understanding of the basis of care provision. Many health professionals still view death as a defeat rather than accepting that death is an inevitable part of living;6 and palliative care may erroneously be seen as relevant only for the last days of life and as being “exclusive of life prolonging treatments”.7 The term “a palliative approach” is increasingly being used to describe care that allows continuation of active interventions while introducing elements of palliative care (Box), but there are few models of care that successfully combine chronic disease management (CDM) and palliative approaches. For CDM and palliative models of care to blend successfully, both need to be expanded to accommodate understandings that recognise their differing perspectives.

The practice of referring patients to palliative care suggests that there is a clear transition from active disease management to an approaching end-of-life period that triggers the referral. However, there is growing evidence that there is no clear transition for patients with chronic disease, but rather, a slow period of decline, where both interventional care and a palliative approach are required.8,9 Indeed, there is currently no common understanding in the Australian context of the term “end of life”. Palliative Care Australia’s definition of end of life (Box) is not specific enough to indicate when a referral should be triggered.3 The End of Life Care Strategy in the United Kingdom defines the end-of-life period as the last 12 months of a person’s life;10 however, this raises the issue of how to prospectively identify the last 12 months for people with advanced chronic disease. The generic “surprise” question (ie, “Would I be surprised if this patient died in the next 6 to 12 months?”) can be useful,9 but it is increasingly being recognised that needs and symptoms should dictate care, rather than prognosis.

It has been suggested that the responsibility for end-of-life care in Australia should lie with general practice;9 however, people with advanced chronic disease who are approaching the end of their lives often receive a complex array of medical services from a range of service providers.8 As people experience exacerbations of disease, care may be centred around acute care hospitals and outpatient departments. These patients may have a private specialist, see their GP regularly or use a combination of health care providers. In these situations, the role of GPs is quite unclear. While a number of GPs have considerable experience in the provision of end-of-life care, current funding mechanisms and practice structures mean that many GPs are unable to allocate the time and resources required. Many people with advanced chronic disease use their GPs for prescriptions and minor care and do not see them as their main health service provider.8 Even if GPs have developed care plans for their patients with chronic and complex diseases, patients may still not see them as their care coordinator.8 In this situation, who makes initial contact with a palliative care service? And how is ongoing patient support coordinated? In the UK, systems such as the Gold Standards Framework (with associated infrastructure) allow health professionals to support patients as they approach the end of life (http://www.goldstandards framework.org.uk). This framework was developed to facilitate the coordination of end-of-life care through primary care, but no infrastructure currently exists in Australia to support a similar process.

The way forward

Patient-centred care

The first step in establishing a model of best practice end-of-life care for people with advanced chronic disease is to adopt a patient-centred approach10 (Box). If care is patient-centred, it follows that it must be based on patient needs and symptoms rather than prognosis, allowing such care to be introduced much earlier in the trajectory of illness. In 1999, Kellehear outlined five foundational principles that guide palliative care from a public health and health-promotion perspective and provide a clear framework for supporting patient-centred end-of-life care.11 For care to be truly patient-centred, people must have access to education and information about end-of-life care issues. In the UK, programs such as Dying matters
(http://www.dyingmatters. org) are fostering community conversations around death and dying.

Leadership

Strategic leadership is vital at all levels of the health system. Chronic disease and palliative care policies need to be revised to allow greater recognition of the importance of end-of-life care in chronic disease and to facilitate articulation between palliative care and chronic disease strategies and policies. Increased funding is required to support flexibility of service provision, particularly around eligibility requirements, and to build infrastructure to support service provision across specialties.

Workforce education

Recognising and prioritising the ongoing professional development and education of all health professionals in the principles of person-centred and palliative care is vital to allow them to provide appropriate care at the end of life.5 There are programs in place for undergraduate education (eg, an Australian palliative care curriculum for undergraduates, http://www.pcc4u.org/index.php/about-pcc4u); however, this is a long-term strategy and other educational opportunities for existing health professionals are required.

The role of specialist palliative care

Specialist palliative care plays a vital role in ensuring access to best-practice end-of-life care for people with advanced chronic disease. The Australian National Palliative Care Strategy suggests that specialist palliative care services have ongoing roles in education and consultation as well as providing expert care for people with particularly complex conditions.5 The patient-centred, holistic approach of specialist palliative care means that it is well placed to support better integration of end-of-life care into the ongoing management of chronic disease in both primary and secondary care.

There has been minimal consideration of how the current health care system can accommodate, integrate and implement the strategies required for quality end-of-life care for people with chronic diseases. In the absence of a clear policy framework and appropriate funding, palliative care services have been attempting to support people with chronic disease, but the growing magnitude of the population requiring care and recognition of their differing needs means they will not be able to continue to do so. It may be that the term “palliative care” allows end-of-life care to be perceived as someone else’s business — the domain of specialist palliative care doctors and nurses. End-of-life care must become part of the routine continuum of care, and the remit of both chronic disease management and end-of-life care services. Using the term “end-of-life care” rather than “palliative care” could help to change health professionals’ attitudes to the skills and training they require to meet the needs of people with chronic disease as they approach the end of their life.

Definitions

Chronic diseases2

Have complex and multiple causes
Usually have a gradual onset, although they can have sudden onset and acute stages
Occur across the life cycle, although they become more prevalent with older age
Can compromise quality of life through physical limitations and disability
Are long term and persistent, leading to a gradual deterioration of health
While usually not immediately life threatening, they are the most common and leading cause of premature mortality

Palliative approach3

A term that has been used to describe care that aims to improve the quality of life for individuals with an eventually fatal condition, and their families, by reducing their suffering through early identification, assessment and treatment of pain, physical, psychological, social, cultural and spiritual needs

Patient-centred care4

Health care that is respectful of, and responsive to, the preferences, needs and values of patients and consumers. The widely accepted dimensions of patient-centred care are respect, emotional support, physical comfort, information and communication, continuity and transition, care coordination, involvement of family and carers, and access to care

End of life3

That part of life where a person is living with, and impaired by, an eventually fatal condition, even if the prognosis is ambiguous or unknown

BK virus-associated progressive multifocal leukoencephalopathy

Progressive multifocal leukoencephalopathy (PML) is associated with the polyomavirus JC virus, while BK virus is causative of polyomavirus-associated nephropathy. We report the first definitive case of BK virus-associated PML. This case highlights the importance of biopsy for aetiologic diagnosis in the setting of viral latency and the absence of clear T-cell dysfunction or biologic therapy.

Clinical record

A 71-year-old woman with a low-grade B-cell non-Hodgkin lymphoma was referred by her haematologist for investigation of a 2-week history of progressive apraxia and right-sided neglect. Her past medical history also included Sjögren syndrome and hypogammaglobulinaemia. Her non-Hodgkin lymphoma was complicated by bone marrow infiltration, low-grade lymphadenopathy and splenomegaly. She had received oral chlorambucil 3 years before, but had not been on any therapy for the past 18 months as her disease was stable. She was receiving 6-weekly immunoglobulin infusions at the time of admission.

On examination, the patient had right upper-limb drift and incoordination, with normal power, reflexes and tone throughout. She had difficulty following three-step commands, and had paraphasia and constructional apraxia. She did not have palpable lymphadenopathy but had an enlarged spleen 10 cm below the costal margin. A computed tomography scan of the chest, abdomen and pelvis revealed stable lymphadenopathy and splenomegaly. Full blood examination and chemistry showed stable mild trilineage pancytopenia with a haemoglobin level of 110 g/L (reference interval [RI], 115–160 g/L), white cell count of 3.6 × 109/L (RI, 4–11 × 109/L) and platelet count of 118 × 109/L (RI, 150–400 × 109/L). Her lactate dehydrogenase level was not elevated. Her liver function test results showed a cholestatic pattern of liver dysfunction with an alkaline phosphatase level of 132 U/L (RI, 20–110 U/L) and a gammaglutamyl transferase level of 72 U/L (RI, 12–43 U/L). She also had stage 3b chronic kidney disease with an associated creatinine level of 157 μmol/L (RI, 40–90 μmol/L). Her CD4+ lymphocyte count was 210 × 106/L (RI, 600–1400 × 106/L). The patient was HIV negative. Her cerebrospinal fluid (CSF) showed five mononuclear lymphocytes (RI, < 5 white cells, all mononuclear) and seven erythrocytes (RR, zero), a normal protein level and no abnormality on lymphocytic immunophenotypic analysis. Real-time 59-nuclease polymerase chain reaction (PCR) assays specific for JC virus (JCV) DNA and BK virus (BKV) DNA were performed on DNA extracted from the CSF. The probes and primers used (Box 1) targeted the coding region of the large T-antigen. JCV DNA was not detected; BKV DNA was detected at a viral load of 11 975 copies/mL (normally undetectable). Cryptococcal antigen testing on serum and CSF was negative, as were PCR tests for Epstein–Barr virus DNA and toxoplasma DNA on CSF. Gadolinium-enhanced magnetic resonance imaging (MRI) of the brain showed two areas of abnormality in the posterior left frontal lobe in the subcortical and the periventricular regions. These areas showed low signal on T1-weighted imaging and high signal on T2-weighted (Box 2) and FLAIR (fluid attenuated inversion recovery) imaging. The deep white matter lesion showed peripheral enhancement. Additionally, non-specific high-T2 signal periventricular abnormalities were found.

While these investigations were proceeding, the patient’s neurological state deteriorated. Although the MRI findings were thought more likely to be consistent with progressive multifocal leukoencephalopathy (PML), a negative PCR result for JCV DNA was against this diagnosis. Consequently, a trial of dexamethasone was administered, as the main radiological differential diagnosis was lymphoma. The patient’s symptoms did not improve. After receipt of the positive PCR result for BKV DNA in the CSF, the possibility of BKV-associated PML was entertained, but as this had not previously been definitively described, a brain biopsy was deemed necessary for a definitive diagnosis. The patient underwent a brain biopsy 1 month after admission.

Deep and superficial brain biopsy samples were taken, yielding eight fragments of tissue 2–4 mm in maximum extent. Sections stained with haematoxylin and eosin showed reactive gliosis with occasional large atypical astrocytes, numerous foamy macrophages and a sparse perivascular mononuclear infiltrate (Box 3). Immunohistochemistry using antibodies for glial fibrillary acidic protein and neurofilaments showed gliosis with relative sparing of axons, in keeping with demyelination. Sections were stained using BK antibody directed against the BKV large T-antigen (Clone BK-T.1, Chemicon International). Intranuclear inclusions in scattered cells stained positively for BKV (Box 3). JCV staining was not performed. Electron microscopy with a JEOL JEM 1011 transmission electron microscope was performed on reprocessed paraffin block material and confirmed the presence of spherical viral particles measuring 40–45 nm, consistent with polyomavirus (Box 4). Cells containing polyomavirus particles showed oligodendrocytic differentiation. Nuclei were large and the cytoplasm showed numerous polyribosomes and rough endoplasmic reticulum. The same PCR protocol as described above was performed on the brain biopsy tissue and was strongly positive for BKV DNA but negative for JCV DNA. Extracted DNA was amplified by an in-house BKV DNA PCR using the primers modified from those originally described.1 The resulting PCR product was sequenced with the same primers, and sequences were confirmed to be BKV DNA using a National Center for Biotechnology Information BLAST search (http://blast.ncbi.nlm.nih.gov). Sequences were 100% concordant with BKV isolate SJH-LG-310 (GenBank accession number JN192440).

A diagnosis of BKV-associated PML was made and, given the irreversible underlying immune deficits, age and progressive neurologic status, a palliative approach was taken. The patient died 6 weeks after undergoing the brain biopsy.

Discussion

The polyomaviruses BK and JC commonly infect humans and remain latent in immunocompetent individuals.2 Both are associated with clinical disease in the setting of immunosuppression — BKV with polyomavirus-associated nephropathy and haemorrhagic cystitis, and JCV with PML.

More recently, BKV has been described as an emerging pathogen in the central nervous system.3 However, its true pathogenicity is complicated by its known central nervous system latency in asymptomatic immunocompetent and immunocompromised individuals.4 This confounds any possible new pathogenic associations with disease.

BKV is newly recognised as a causative agent of meningoencephalitis and has been demonstrated in the tissue and CSF of affected patients.5–8 To our knowledge, there have been two proposed cases of BKV-associated PML described in the literature. However, definitive diagnoses were not made in these cases, as both relied on BKV isolated from CSF as a surrogate marker, with no evidence of BKV in the tissue.9,10 Given the problem of latency in multiple tissues, though, it was plausible to assert that BKV was the causative agent. Nevertheless, a brain biopsy was deemed necessary for diagnosis in the case we describe.

JCV-associated PML is most commonly associated with HIV/AIDS. It is also known to occur in patients with multiple sclerosis who are treated with natalizumab and in individuals with idiopathic CD4+ lymphopenia and other T-cell deficient states.11,12 It is plausible to assume that, similarly, a T-cell immunodeficiency may be necessary to predispose an individual to BKV-induced PML. Although the patient described had both Sjögren syndrome and a haematological malignancy with known hypogammaglobulinaemia, her T-cell count was above that generally associated with HIV-associated PML, at 210 cells/μL at the time of diagnosis. However, a functional T-cell impairment is still a possible predisposing factor for the development of disease in this case.

In our patient, the presence of BKV DNA without JCV DNA in the CSF brain biopsy specimens, and the associated findings on histopathology and electron microscopy, support the diagnosis of BKV-induced PML. Although JCV-specific immunohistochemistry was not performed, the stain used is reportedly specific for BKV and does not cross-react with JCV or the related polyomavirus, Simian virus 40.13 DNA sequencing definitively established the presence of BKV DNA in our patient’s brain tissue and, consequently, we suggest that this evidence supports our diagnosis of the first biopsy-proven case of BKV-associated PML.

1 JC virus (JCV) and BK virus (BKV) large T-antigen primers and probes

Designation

Sequence, 59–39

Primer

BKV forward

TGCTTCTTCATCACTGGCAAAC

BKV reverse

GGTGCCAACCTATGGAACAGA

JCV forward

TGATGGTTAAAGTGATTTGGCTGAT

JCV reverse

TTGCTTATGGGCATGTACTTAGACTTT

Probe

BKV

CACCAGGACTCCCAC (6-FAM fluorophore and MGB-NF quencher*)

JCV

TCACATTTTTTGCATTGCT (6-FAM fluorophore
and MGB-NF quencher*)

* FAM = 6-carboxyfluorescein. MGB-NF = minor-groove binding
non-fluorescence.

2 Gadolinium-enhanced magnetic resonance image of the patient’s brain

T2-weighted image showing high signal in the periventricular (solid arrow) and subcortical (dashed arrow) white matter of the posterior left frontal lobe. ◆

3 Stained histological sections of the patient’s deep brain biopsy specimen

Main image: Haematoxylin and eosin staining (original magnification, 340) showing two cells with well defined intranuclear inclusions. Insert: Immunoperoxidase staining for BK-T antigen showing variable but focally strong nuclear staining (original magnification, 340). ◆

4 Transmission electron micrograph of viral particles in the patient’s deep brain biopsy specimen

Main image: Part of an infected glial cell (C) and part of the cell nucleus (N) (original magnification, 330 000). A myelinated axon can also be seen (arrow). Insert: A nucleus with polyoma-type viral particles 40–45 nm in diameter (original magnification, 3120 000). ◆